
1117 Primery na diagnostiku BRCA1, BRCA2

Detaily obstarávania

Univerzita Komenského v Bratislave, Jesseniova lekárska fakulta Martin
Typ obstarávania:
EU fondy:
Odhadovaná suma(Bez DPH):
Konečná suma(Bez DPH):
Hlavný CPV kód:
Elektronická aukcia:
Rámcová dohoda:
Použitý postup:
§ 110 ZVO
Kompletný predmet zákazky
Počet uzavretých zmlúv:

Ponuky vyhodnotené podľa

Cena bez DPH

Opis obstarávania

Funkčná špecifikácia

Názov; Oligo sekvencia 5' → 3'; Koncentrácia (umol) ; Počet báz; Purifikácia; Množstvo; 1F_BRCA2; TTGCCCCTTTCGTCTATTTG; 0,025; 20; odsolené; 1 kus ; 1R_BRCA2; AAGTGGCCCTCTTTTGGACT; 0,025; 21; odsolené; 1 kus; 1F_BRCA1; GGCAACGAAACTGGACTCAT; 0,025; 20; odsolené; 1 kus; 1R_BRCA1; CGGCTAATTGTGCTCACTGT; 0,025; 20; odsolené; 1 kus; 2F_BRCA2; ACAGACAAAAGCAAAACATTGAT; 0,025; 23; odsolené; 1 kus; 2R_BRCA2; CTTGATTGGAGTTGTTTTTGTTAAA; 0,025; 25; odsolené; 1 kus; 3F_BRCA2; ACCCAAGCTCTTTTGTCTGG; 0,025; 20; odsolené; 1 kus; 3R_BRCA2; GTCTGAGATAATCTTCTGAACTGGTG; 0,025; 26; odsolené; 1 kus; 2F_BRCA1; TCTGCATTGAAAGTTCCCCA; 0,025; 20; odsolené; 1 kus; 2R_BRCA1; ACAAATTCTTCTGGGGTCAG; 0,025; 20; odsolené; 1 kus; 3F_BRCA1; GCCAGCTCATTACAGCATGA; 0,025; 20; odsolené; 1 kus; 3R_BRCA1; CTCTCACACAGGGGATCAGC; 0,025; 20; odsolené; 1 kus; 4F_BRCA2; TGGAAAGTCAATGCCAAATG; 0,025; 20; odsolené; 1 kus; 4R_BRCA2; TGGATCAGTATCATTTGGTTCC; 0,025; 22; odsolené; 1 kus; BRAF15 F; TCATAATGCTTGCTCTGATAGGA; 0,04; 23; odsolené; 1 kus; BRAF 15 R; GGCCAAAAATTTAATCAGTGGA; 0,2; 22; odsolené; 1 kus; Braf ASI F; GTGATTTTGGTCTAGCTACAGT; 0,04; 22; odsolené; 1 kus; Braf ASII F; GTGATTTTGGTCTAGCTACAGA; 0,04; 22; odsolené; 1 kus

Technická špecifikácia textová

Technická špecifikácia číselná

Zoznam uzavretých zmlúv ku obstarávaniu

Ak je viac zmlúv ku jednému obstarávaniu platí nasledovné: V prípade, že sumy na jednotlivých zmluvách sa zhodujú navzájom a aj s celkovou sumou za obstarávanie, s najväčšou pravdepodobnosťou sa v čase uverejnenia ešte nevedelo presné rozdelenie súm pre jednotlivých dodávateľov, alebo sú zle vyplnené vo vestníku.
Dodávateľ Spomedzi uchádzačov Suma kontraktu DPH Mena Dátum uzavretia kontraktu Detaily
K-TRADE spol. s r.o. 2 125,00 0% EUR 12. Jún 2017 140061

Zoznam dokumentov ku obstarávaniu

Všetky dokumenty sú spárované podla čísla obstarávania z portálu UVO. V prípade, že sa jedná o rozdelené obstarávanie, môžu byť zobrazené všetky súvisiace dokumenty.
Žiadne dokumenty neboli nájdené!

Zoznam výsledkov obstarávaní

Pozor! Konečná suma je vypočítaná ako celková hodnota uzavretých zmlúv (po odpočítaní DPH) v rámci obstarávania. Ak nie sú správne vyplnené jednotlivé sumy, či DPH ku zmluvám vo vestníku, celková suma a aj pomer v % bude nesprávny. Všetky výpočty sú len informatívne.
Názov obstarávania Obstarávateľ Odhadovaná suma (Bez DPH) Konečná suma (Bez DPH) Zaplatené Mena Rok Typ EU fondy Počet zmlúv Úspešné

Zoznam vyhlásených obstarávaní

Názov obstarávania Obstarávateľ Suma obstarávania Suma obstarávania_hidden Mena Dátum zverejnenia Lehota na predkladanie ponúk EU fondy DT_hidden Lehota_hidden

Vyhľadávač v dokumentoch obstarávania

Vyhľadávač poskytuje full-text vyhľadávanie v dokumentoch, ktoré boli priložené ku aktuálnemu obstarávaniu. Z dôvodu kolísavej kvality vstupných dokumentov za správnosť údajov strojového spracovania neručíme. V prípade rámcovej zmluvy, či rozdeleného obstarávania môže jeden dokument patriť viacerým obstarávaniam.

Vyhľadávač v dokumentoch obstarávania je prémiová funkcia dostupná pri podpore 8 a viac dolárov mesačne na portáli Patreon. V prípade, že už ste podporovateľ, prihláste sa a funkcia sa vám odomkne.

Prihlás sa cez Patreon

Podporte UVOstat pre dobrý pocit, prémiové funkcie a všetko bez reklám.

Become a patron button@2x